Order custom papers, masters thesis and dissertation in 3 guided steps; human written!
Posted: February 9th, 2023
Take a look at Extended Data Figure 3 from Huerta-Sánchez et al (2014: 2024 - Essay Writing Service | Write My Essay For Me Without Delay). How does this figure emphasize that the Tibetan allele for EPAS1 came from Denisovans? (10 points)
2. You are given the following seven aligned sequences from a single population (variants with respect to the first sequence are shown in bold). Justify whether or not you see any evidence of selection. (20 points)
TGGAGTGTGACCATAGCGAT
TGGAGTTTGACCATAGCCAT
TGGAGTGTGACCATAACCAT
TGGTGTTTGCCCATAACGAT
TGGTGTGTGACCATAGCGAT
TGGTGTGTGCCCATAGCGAT
TGGAGTGTGACCATAACGAT
We handpick every writer with care, ensuring they bring the perfect mix of academic qualifications and writing skills for top-notch results in essays, research papers, and dissertation help. Each one has a university degree, more than a third with Masters certification; they’ve tackled tough tests and training to excel in thesis writing and research paper assignments at any time. They’ll team up with you diligently, keeping things easy and stress-free as they relate to being immediate students. That’s what makes us the best assignment help website for "help me write my essay, research paper, or dissertation" for college coursework. Trust our team—professional research essay writers and editors—to deliver your dissertation or thesis writing within your grading criteria and deadline.
3. Explain the concept of the "Neutral Theory of Molecular Evolution" and how it relates to the idea of a molecular clock? (10 points)
Extended Data Figure 3 from Huerta-Sánchez et al (2014: 2024 - Essay Writing Service | Write My Essay For Me Without Delay) shows the distribution of alleles for the gene EPAS1 in various populations. The figure emphasizes that the Tibetan allele for EPAS1 came from Denisovans by showing that this particular allele is found only in Tibetans and Denisovans, and not in any other populations studied. This suggests that the allele was introduced into the Tibetan population through interbreeding with Denisovans.
The seven aligned sequences show evidence of genetic variation within the population, but it is not possible to determine if there is evidence of selection based on this limited data. To determine if selection is occurring, additional information is needed, such as the functional significance of the alleles, the frequency of the alleles in the population, and whether the alleles are associated with any particular traits.
The Neutral Theory of Molecular Evolution posits that most evolutionary changes at the molecular level, such as changes in DNA sequences, are due to neutral processes such as genetic drift and mutation, rather than natural selection. The concept of a molecular clock refers to the idea that the rate of accumulation of mutations in DNA sequences is roughly constant over time, allowing the estimation of evolutionary divergence times between species based on the number of differences in their DNA sequences. The Neutral Theory suggests that this molecular clock reflects the accumulation of neutral mutations, which are not subject to natural selection and therefore evolve randomly over time.
You Want Quality and That’s What We Deliver
We’ve put together our writing team with care, choosing talented writers who shine in their fields. Each one goes through a tough selection process, where we look for folks with deep expertise in specific subjects and a solid history of academic writing. They bring their own mix of know-how and flair to the table, making sure our content hits the mark—packed with info, easy to read, and perfect for college students like you.
We don’t do AI-written essays or copycat work—everything’s original. Competitive pricing is a big deal for us; we keep costs fair while delivering top-notch quality. Our writers are some of the best out there, and we charge rates that stack up well against other services. This means you get stellar content without draining your wallet. Our pricing is straightforward and honest, built to give you real value for your money. That’s why students turn to us for high-quality writing services that won’t break the bank.
Academic integrity is at the heart of what we do. Every paper starts from scratch, with original research and writing tailored just for you. We write 100% authentic—no plagiarism research essays. Our strict quality control process includes scanning every draft with top tools like SafeAssign and Turnitin, so you get a similarity score and proof of originality. We’re obsessive about proper citation and referencing too, crediting every source to keep things legit. It’s all about giving you peace of mind with content that meets the highest standards.
When you decide to place an order with Dissertation Writer, here is what happens: