Order custom papers, masters thesis and dissertation in 3 guided steps; human written!
Posted: July 13th, 2022
TASK 1:
You need to devise a cloning scheme to solve the following problem. An insert is available and it contains a gene within it, whose exact position and orientation within the insert are unknown. This gene contains a sequence for an important small peptide hormone. No DNA sequence information is available. The insert is shown below with a strategic restriction site indicated. The specific task to be set out as an experimental strategy is as follows:
Absolutely! We prioritize fast delivery to ensure your dissertation, research paper, or thesis writing is completed well before the deadline. This gives you time for last-minute tweaks—like edits, corrections, or revisions—for dissertation help or essays. Need urgent homework or dissertation assistance? Reach out today and boost your chances of scoring top marks in your grading rubrics with our expert research paper and thesis writing support!
You have accepted a consultancy contract to provide a large amount of the purified peptide to a new medical centre that needs the peptide to treat patients. It is a new peptide on a DNA fragment just isolated and provided to you and is therefore not yet in commercial production. Of course it would be a simple task to sequence the insert and go from there, but for the purpose of this hypothetical exercise sequencing is unavailable.
Set up an experimental scheme that takes into account the task described above, beginning with the insert and the expression vector pUC18. A map of pUC18 with all features indicated, including the multi-cloning site, may be easily obtained by typing the vector name into Google.
The insert containing the peptide gene is a blunt-ended fragment of 1.8 kb that was not generated with a restriction enzyme. A single unique restriction site is indicated on the fragment. The size of the gene is unknown, but what is known is: (a) the orientation, which is right to left in the drawing below; (b) the gene does not have a promoter; and (c) there is a 6x His tag at the C-terminus of the Open Reading Frame (ORF).
TASK 2:
Every dissertation, research paper, or thesis we deliver is researched and written from scratch, ensuring original content tailored just for you. You’ll be the only one with access to the final dissertation or research paper, complete with proper references. Your privacy is our top priority. When you order dissertation help or thesis writing from us, your identity and payment details stay confidential, minimizing any risk of detection or content theft by third parties. We help you stay discreet, so you can focus on your goals.
A gene, named LmrA, has been cloned into pUC18. It is aligned directionally with the 5-prime and 3-prime ends of the gene ligated into the BamHI and EcoRI sites of pUC18 (see the figure below). The sites precede and follow the ORF, but with extra sites in between (see the Figure below). In a subsequent cut-and-paste exercise, all of the extra sites were deleted so that LmrA is now abutted precisely with the preceding BamHI and tailing EcoRI sites, respectively. At the 5-prime end, the sequence begins GGATCCATG; and at the 3-prime end, the sequence concludes TAAGAATTC. The underlined bases are the start (ATG) and stop (TAA) codons for the gene. The other six bases are the BamHI and EcoRI sites at either end of the ORF.
The researcher who has this clone wants to run a series of experiments that will identify the expressed protein in Western blots, for which an antibody is required to identify the specific protein in a gel lane containing many proteins from a cell lysate. One simple way of achieving identification, and at some later stage, purification of the protein, is to have a specific monoclonal antibody to identify the protein. However, no such antibody is available, but a common practice in these circumstances is to insert an epitope at one end of the gene so that a specific antibody to the epitope will enable the identification and purification tasks.
Need help with dissertation, thesis writing, or research papers? Our ace my homework platform is the go-to solution for college students across Australia, the UK, the USA, China, and the UAE—plagiarism-free and without AI. Share your requirements via our simple order form, secure your spot with an escrow payment, and we’ll match you with a skilled writer for dissertation help or research paper expertise. Wondering if we’re reliable? We’ve earned a 4.9/5 rating on Sitejabber and Trustpilot, backed by glowing testimonials. Plus, we offer affordable dissertation and thesis writing support—so even on a tight budget, you get maximum quality.
Such an antibody is one that recognizes a hexameric histidine sequence (6x) attached to either the N- or C-terminus of the ORF of the cloned gene. The 6x His codon sequence (CAT.CAT.CAT.CAT.CAT.CAT) will have to be attached to LmrA at either the N- or C-terminal end. The cloning/attachment scheme may be performed using PCR and appropriate forward and reverse overlapped primers and an appropriate restriction site. An example of this type of scheme is relatively easy to set up, using either of the sequences given in the first paragraph above.
Set out your scheme for the attachment of the 6x histidine sequence to the (front) N-terminal end of LmrA within the recombinant plasmid. To do this, you will need a longer sequence than the one given in paragraph 1, that is, with a few extra codons added to the ATG start codon so that the primers will be long enough and overlap for the PCR. The sequence of the top strand should therefore include: GGATCCATGGAAAGAGGTCCACAA, where the first six codons of LmrA are underlined. Don’t forge the 6x histidine tag (CATCATCATCATCATCAT) needs to be incorporated in the new clone sequence AND correctly! Biology Assignment: I need help writing a research paper.
You Want Quality and That’s What We Deliver
We’ve put together our writing team with care, choosing talented writers who shine in their fields. Each one goes through a tough selection process, where we look for folks with deep expertise in specific subjects and a solid history of academic writing. They bring their own mix of know-how and flair to the table, making sure our content hits the mark—packed with info, easy to read, and perfect for college students like you.
We don’t do AI-written essays or copycat work—everything’s original. Competitive pricing is a big deal for us; we keep costs fair while delivering top-notch quality. Our writers are some of the best out there, and we charge rates that stack up well against other services. This means you get stellar content without draining your wallet. Our pricing is straightforward and honest, built to give you real value for your money. That’s why students turn to us for high-quality writing services that won’t break the bank.
Academic integrity is at the heart of what we do. Every paper starts from scratch, with original research and writing tailored just for you. We write 100% authentic—no plagiarism research essays. Our strict quality control process includes scanning every draft with top tools like SafeAssign and Turnitin, so you get a similarity score and proof of originality. We’re obsessive about proper citation and referencing too, crediting every source to keep things legit. It’s all about giving you peace of mind with content that meets the highest standards.
When you decide to place an order with Dissertation Writer, here is what happens: